python - How to convert text file with two columns to fasta format -


i kind of confused bit of code. have testfile.txt

sclsc1_3349_ss1g_09805t0        ttgcgatctatgccgacgttcca sclsc1_8695_ss1g_14118t0        atggtttcggc sclsc1_12154_ss1g_05183t0       atggtttcggc sclsc1_317_ss1g_00317t0         atggtttcggc sclsc1_10094_ss1g_03122t0       atggtttcggc 

i want convert file format (fasta) below:

>sclsc1_3349_ss1g_09805t0 ttgcgatctatgccgacgttcca >sclsc1_8695_ss1g_14118t0 atggtttcggc >sclsc1_12154_ss1g_05183t0 atggtttcggc >sclsc1_317_ss1g_00317t0 atggtttcggc >sclsc1_10094_ss1g_03122t0 atggtttcggc 

here python code (run like: python mycode.py testfile.txt outputfile.txt, not output result wanted. can please me correct code? thanks!

import sys  #file input fileinput = open(sys.argv[1], "r")  #file output fileoutput = open(sys.argv[2], "w")  #seq count count = 1 ;  #loop through each line in input file print "converting fasta..." strline in fileinput:      #strip endline character each input line     strline = strline.rstrip("\n")      #output header     fileoutput.write("> " + str(count) + "\n")     fileoutput.write(strline + "\n")      count = count + 1 print ("done.")  #close input , output file fileinput.close() fileoutput.close() 

as on linux os, here short , fast awk one-liner:

awk '{ printf ">%s\n%s\n",$1,$2 }' testfile.txt > outputfile.txt 

the outputfile.txt contents:

>sclsc1_3349_ss1g_09805t0 ttgcgatctatgccgacgttcca >sclsc1_8695_ss1g_14118t0 atggtttcggc >sclsc1_12154_ss1g_05183t0 atggtttcggc >sclsc1_317_ss1g_00317t0 atggtttcggc >sclsc1_10094_ss1g_03122t0 atggtttcggc 

Comments

Popular posts from this blog

ZeroMQ on Windows, with Qt Creator -

unity3d - Unity SceneManager.LoadScene quits application -

ios - MKAnnotationView layer is not of expected type: MKLayer -